A multi-stage malaria vaccine candidate targeting both transmission and asexual parasite life-cycle stages
Introduction
Considerable reductions in the burden of malaria have been observed in the last decade in association with up-scaling of malaria control efforts. It is, however, acknowledged that further up-scaling with currently available tools are unlikely to result in malaria elimination in the majority of African settings [1]. Novel tools that specifically reduce the transmission of malaria from man to mosquito are needed for this purpose [2]. A vaccine that targets sexual and/or sporogonic development would be of great value for malaria elimination strategies. Classical transmission-blocking malaria vaccines (TBMV), however, do not provide direct protection against clinical disease caused by pathogenic asexual stages. Clinical development of a multi-stage chimeric vaccine incorporating both sexual and asexual blood-stage components inducing functional antibody responses, can address this limitation providing both direct personal protection and delayed benefit by reducing transmission and risk for new infections.
The sexual stage Pfs48/45 antigen is a well-established lead TBMV candidate because of its critical role in parasite fertilisation [3], [4]. Series of monoclonal antibodies (mAbs) have been generated [5] against distinct B-cell epitopes with the capacity to completely block the generation of infected mosquitoes when tested in the standard membrane feeding assay (SMFA). Pfs48/45 is a cysteine-rich protein with multiple disulfide bonds and most transmission blocking B-cell epitopes depend on tertiary structures [6]. Since Pfs48/45 is expressed in gametocytes once the parasite undergoes sexual differentiation in the human host [7], [8], naturally acquired anti-Pfs48/45 antibodies are found in sera from endemic populations, and presence of these antibodies is associated with transmission blocking activity [6], [9], [10], [11]. Although attractive from this perspective for clinical vaccine development, Pfs48/45 has proven to be a difficult target for production in most heterologous expression systems [3], [4], [12], [13], [14], [15], [16], [17].
The asexual blood-stage antigen Glutamate-rich Protein (GLURP) has been identified as a target of naturally acquired immunity against malaria [18], [19], [20]. Results from epidemiological studies show strong correlation between the presence of cytophilic anti-GLURP antibodies and protection against clinical malaria [20]. IgG preparations derived from endemic sera and from volunteers participating in a phase-1 GLURP vaccine trial have been shown to functionally inhibit parasite growth in vitro in co-operation with monocytes [19], [21], [22], [23]. Finally, GLURP is part of the GMZ2 vaccine which is an asexual hybrid protein currently tested in a multicentre phase IIb trial in Africa. It has been relatively easy to produce GLURP in recombinant form [24], [25] and especially food grade Lactococcus lactis has been an ideal expression system [24], most likely because L. lactis exhibits similar codon bias as Plasmodia and therefore does not require codon optimisation or harmonisation prior to heterologous expression [26].
Here, we have produced a correctly-folded functional fragment of Pfs48/45 (10C) as a chimeric antigen fused in frame with a section of GLURP (GLURP.RO) in L. lactis. Purified R0.10C induced functional antibodies in rats showing both TB activity and asexual growth inhibition against a panel of Pf strains of different geographical origin.
Section snippets
Construction of plasmid and growth conditions
pLEA5: glurp79-1500 fragment (Genbank M59706) was amplified from F32 gDNA with the primers 5′-CCAGATCTACAAGTGAGAATAGAAATAAACGAATC (GA52) and 5′-CTATACTTGATATAACCTTTTCAGTATTATCTGCTTCATGCTCGCTTTTTTCCGATTC (GA4), and the pfs48/45475-1284 fragment (corresponding to bp 475–1282 of Genbank: NC_004331.2) was amplified from 3D7 gDNA using the primers 5′-GAATCGGAAAAAAGCGAGCATGAAGCAGATAATACTGAAAAGGTTATATCAAGTATAG (GA12) and 5′-CCAGATCTCTAATGGTGATGATGGTGATGTGCTGAATCTATAGTAACTGTCATATAAG (GA53). The GA53
Expression, purification and characterisation of monomeric R0.10C
Development of a Pfs48/45-based subunit vaccine has been a formidable task because correct folding of TB epitopes is essential for its capacity to elicit functional antibodies [4]. Here, we have used a set of TB mAbs to guide the expression of correctly folded Pfs48/45. A Chimeric protein (R0.10C) was generated between the N-terminal part of GLURP (R0) and the C-terminal part of Pfs48/45 (10C) (Fig. 1A). The corresponding plasmid, pLEA5, was transformed into L. lactis MG1363 resulting in clonal
Discussion
The multi-stage life cycle of Pf with distinct antigenic composition and function provides the opportunity to simultaneously target both sexual and asexual blood stages for vaccine development purposes. In this study a multi-stage chimera was generated containing the blood-stage vaccine candidate GLURP.R0 fused in frame to C-terminal 10-cysteine (10C) fragment of sexual-stage protein Pfs48/45. For the latter we focussed on conformational epitope I, a major target for TB antibodies [30].
Conflicts of Interests
The authors report no conflicts of interests.
Acknowledgements
This work was supported by Seventh Framework Program Theme Health-2009-2.3.2-5, Grant 242079, and Proof of Concept funding, Ministry of Science, Innovation and Higher Education, Denmark. The authors would like to thank Dr. Tom Churcher (Imperial College, London, UK) for support in data analysis, Tenna Jensen for technical assistance.
References (47)
Transmission blocking malaria vaccines
Vaccine
(2001)Surface antigens of Plasmodium falciparum gametocytes—a new class of transmission-blocking vaccine targets
Mol Biochem Parasitol
(2009)- et al.
Cloning and expression of the gene coding for the transmission blocking target antigen Pfs48/45 of Plasmodium falciparum
Mol Biochem Parasitol
(1993) - et al.
Plasmodium falciparum: heterologous synthesis of the transmission-blocking vaccine candidate Pfs48/45 in recombinant vaccinia virus-infected cells
Exp Parasitol
(1998) - et al.
Assembly and expression of a synthetic gene encoding the antigen Pfs48/45 of the human malaria parasite Plasmodium falciparum in yeast
Vaccine
(2000) - et al.
Glutamate-rich protein (GLURP) induces antibodies that inhibit in vitro growth of Plasmodium falciparum in a phase 1 malaria vaccine trial
Vaccine
(2007) - et al.
Identification of a major B-cell epitope of the Plasmodium falciparum glutamate-rich protein (GLURP), targeted by human antibodies mediating parasite killing
Vaccine
(2000) - et al.
A Plasmodium falciparum GLURP-MSP3 chimeric protein; expression in Lactococcus lactis, immunogenicity and induction of biologically active antibodies
Vaccine
(2004) Lactococcus lactis-based vaccines from laboratory bench to human use: an overview
Vaccine
(2012)- et al.
Cultivation of fertile Plasmodium falciparum gametocytes in semi-automated systems
1. Static cultures. Trans R Soc Trop Med Hyg
(1982)
Epitope analysis of the malaria surface antigen pfs48/45 identifies a subdomain that elicits transmission blocking antibodies
J Biol Chem
Measurement by membrane feeding of reduction in Plasmodium falciparum transmission induced by endemic sera
Trans R Soc Trop Med Hyg
Uses of mosquito-stage transmission-blocking vaccines against Plasmodium falciparum
Trends Parasitol
Measuring the blockade of malaria transmission—an analysis of the Standard Membrane Feeding Assay
Int J Parasitol
Evidence of non-neutral polymorphism in Plasmodium falciparum gamete surface protein genes Pfs47 and Pfs48/45
Mol Biochem Parasitol
Conservation and heterogeneity of the Glutamate-rich protein (GLURP) among field isolates and laboratory lines of Plasmodium falciparum
Mol Biochem Parasitol
Plasmodium falciparum: production and characterization of rat monoclonal antibodies specific for the sexual-stage Pfs48/45 antigen
Exp Parasitol
Reducing Plasmodium falciparum malaria transmission in Africa: a model-based evaluation of intervention strategies
PLoS Med
A research agenda to underpin malaria eradication
PLoS Med
A potent malaria transmission blocking vaccine based on codon harmonized full length Pfs48/45 expressed in Escherichia coli
PLoS One
Correctly folded Pfs48/45 protein of Plasmodium falciparum elicits malaria transmission-blocking immunity in mice
Proc Natl Acad Sci U S A
Epidemiology and infectivity of Plasmodium falciparum and Plasmodium vivax gametocytes in relation to malaria control and elimination
Clinical Microbiology Reviews
A comparison of transmission-blocking activity with reactivity in a Plasmodium falciparum 48/45-kD molecule-specific competition enzyme-linked immunosorbent assay
Am J Trop Med Hyg
Cited by (80)
The RH5-CyRPA-Ripr Complex as a Malaria Vaccine Target
2020, Trends in ParasitologyThe Plasmodium falciparum circumsporozoite protein produced in Lactococcus lactis is pure and stable
2020, Journal of Biological Chemistry